Error In Sqliteexecstatement
Contents |
here for a quick overview of the site Help Center Detailed answers to any questions you might have Meta Discuss the workings and policies of this site About Us Learn more about Stack Overflow the company Business Learn more about hiring error in .verify.jdbc.result(s, "unable to execute jdbc statement ", statement) : developers or posting ads with us Stack Overflow Questions Jobs Documentation Tags Users Badges Ask Question
Error In Statement Near Syntax Error
x Dismiss Join the Stack Overflow Community Stack Overflow is a community of 4.7 million programmers, just like you, helping each other. Join them; rh2 package in r it only takes a minute: Sign up Can't use sqldf on my data frame anymore (Error in sqliteExecStatement) up vote 1 down vote favorite (I'm rather new to R.) I don't know why I get the following error: > apps.rsd.c
Error In Statement: No Such Column:
<- sqldf("SELECT appid FROM apps.rsd WHERE rcount > 50") Error in sqliteExecStatement(con, statement, bind.data) : RS-DBI driver: (error in statement: no such table: apps.rsd) I thought these might help, I tried to compare them to data frames which let me work with sqldf, but didn't see what causes the error: > dput(head(apps.rsd)) structure(list(appid = c(173L, 717L, 996L, 209L, 602L, 255L), cid = c(4L, 15L, 21L, 5L, 13L, 6L), price = c(0, 0, 0, 1.99, 0, 0.76), count = c(411, error in sqlitesendquery conn statement bind data 411, 210, 18, 921, 22), sum = c(1226, 1870, 871, 66, 3948, 86), mean = c(2.98296836982968, 4.54987834549878, 4.14761904761905, 3.66666666666667, 4.28664495114007, 3.90909090909091 ), sd = c(1.73897694746568, 0.958668345866094, 1.31370760232218, 1.7950549357115, 1.33373734360862, 1.62114131819336), rcount = c(3, 3, 3, 5, 5, 7), rsum = c(7, 0, 0, 13, 0, 19), rsd = c(2.3094010767585, 2.3094010767585, 2.3094010767585, 2.19089023002066, 2.19089023002066, 2.1380899352994)), .Names = c("appid", "cid", "price", "count", "sum", "mean", "sd", "rcount", "rsum", "rsd"), class = c("data.table", "data.frame"), row.names = c(NA, -6L), .internal.selfref =
pgsql-announce pgsql-bugs pgsql-docs pgsql-general pgsql-interfaces pgsql-jobs pgsql-novice pgsql-performance pgsql-php pgsql-sql pgsql-students Developer lists Regional lists Associations User groups Project lists Inactive lists
Raw() Can Only Be Applied To A 'raw', Not A 'character'
IRC Local User Groups Featured Users International Sites Propaganda Resources Weekly
Sqldf No Such Column
News Re: Sqldf - error message From: Pavel Stehule
bind.data) : , bind.data https://support.bioconductor.org/p/43700/ must have non-zero dimensions 0 4.6 years ago https://support.bioconductor.org/p/54583/ by mabawsa • 20 mabawsa • 20 wrote: Hi, I get "Error in sqliteExecStatement(con, statement, bind.data) : , bind.data must have non-zero dimensions" when run. It seems similar this error https://stat.ethz.ch/pipermail/bioconductor/2011-February/037796.html. I generated error in the pos file myself. I guess the SEQ_ID on the NDF file is strange but the entry at 194289 and 194290 seems to be OK. SEQ_ID MISMATCH PROBE_CLASS PROBE_ID 194288 CHR9:46353-46389 0 experiment CHR0999P000090528 194289 CHR13:230623-230659 0 experiment CHR1300P000332204 194290 CHR13:595769-595805 0 error in statement experiment CHR1300P000337972 194291 CHR1:85497-85533 0 experiment CHR0100P000197636 Any Help would be greatly appreciated... Here is my script library('oligo', quietly=TRUE) library('ff', quietly=TRUE) library('pdInfoBuilder', quietly=TRUE) library('genefilter', quietly=TRUE) library('limma', quietly=TRUE) library('RColorBrewer', quietly=TRUE) palette(brewer.pal(8, "Dark2")) data.dir <- "/microarray-data/ExtractedData/xys" #point to where the data is stored annotation.dir <- "/RNA/NASA/" xys.files <- list.xysfiles(data.dir, full.names = TRUE) pos.file <- list.files(annotation.dir, pattern=".pos", full.names = TRUE) ndf.file <- list.files(annotation.dir, pattern=".ndf", full.names = TRUE) #################################################### ## Make info package MUST have only one POS and ## ## NDF file in the directory ## #################################################### seed <- new("NgsTilingPDInfoPkgSeed", ndfFile = ndf.file, xysFile = xys.files[1], posFile = pos.file, author = "x", email = "x at gmail.com", biocViews = "AnnotationData", genomebuild = "S288C_reference_genome_R49-1-1_20051216", organism = "Yeast", manufacturer="Nimblegen", species = "Saccharomyces cerevisiae", url = "http://google.com") makePdInfoPackage(seed, destDir=annotation.dir)
bind.data) : bind.data must have non-zero dimensions 0 3.1 years ago by Nitesh Turaga • 50 Nitesh Turaga • 50 wrote: Hi, I'm a little stuck with the charm analysis using MeDip arrays. It started with an error at "readCharm" and trickled into the finer details of what information the function needed. I have seen the previous question in https://stat.ethz.ch/pipermail/bioconductor/2012-February/043719.html . Here, the user built a custom ".pos" file. But the ".pos" file i'm using is from nimblegen and so is the ".ndf". I do not have a column in which "experimental" or otherwise is mentioned. My .pos file looks like this, PROBE_ID SEQ_ID CHROMOSOME POSITION COUNT LENGTH GC CHR01FS000015738 chr1:15366-44081 chr1 15738 3 50 0.68 CHR01FS000016058 chr1:15366-44081 chr1 16058 2 50 0.70 CHR01FS000016770 chr1:15366-44081 chr1 16770 5 50 0.54 And my .ndf file looks like this. PROBE_DESIGN_ID CONTAINER DESIGN_NOTE SELECTION_CRITERIA SEQ_ID PROBE_SEQUE NCE MISMATCH MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS PROBE_ID PO SITION DESIGN_ID X Y DMD 537151_1_25 BLOCK1 interval rank target_tm:76.00;probe_tm:77.60;freq: 9.25;count:01;rules:0000;score:0812 chr19:6588109-6599163 AAAAGACCAGAAAACAG GGCACGGACGTAAGCAGAGAGGTTCTATGTGTC 0 254819035 254819035 25 1 CHR19FS006590 155 6590155 537151 1 25 A03 537151_1_27 BLOCK1 interval rank target_tm:76.00;probe_tm:75.70;freq:10.71;count:01;rules:0000;score:08 28 chr5:83677266-83688611 GGAGTTACATATCCTTATCAAATCCCAGGCATTAATGCAAGTAAATTGC AACCCATACG 0 254968001 254968001 27 1 CHR05FS083677686 83677686 537151 1 2 7 A03 > ndf = list.files(".",pattern = ".ndf",full.names = TRUE) > pos = list.files(".",pattern = ".pos",full.names = TRUE)[1] > files = list.files("Lung Cancer/2.1M/XYS",pattern = ".xys",full.names = >T)[1] > pkg = new("NgsTilingPDInfoPkgSeed",ndfFile = ndf, xysFile = >files,posFile = pos, author = "Nitesh Turaga",email = >"nturaga at andrew.cmu.edu